Reporter Vector Sequencing Primers

The Reporter Vector (RV) Sequencing Primers are designed for use with the pGL3 and pGL4 Luciferase Vectors, Chroma-Luc™ Vectors and pCAT®3 Reporter Vectors. RVprimer3 binds upstream of the luc+, luc2 or CAT gene, and sequencing runs clockwise across the multiple cloning region. RVprimer4 binds downstream of the luc+, luc2 or CAT polyadenylation region in the Promoter and Basic Vectors and downstream of the SV40 enhancer region of the Enhancer and Control Vectors. Both primers can be used for sequencing double-stranded templates, but only RVprimer4 can be used for sequencing single-stranded templates.

Primer...

Expand to Read More »

The Reporter Vector (RV) Sequencing Primers are designed for use with the pGL3 and pGL4 Luciferase Vectors, Chroma-Luc™ Vectors and pCAT®3 Reporter Vectors. RVprimer3 binds upstream of the luc+, luc2 or CAT gene, and sequencing runs clockwise across the multiple cloning region. RVprimer4 binds downstream of the luc+, luc2 or CAT polyadenylation region in the Promoter and Basic Vectors and downstream of the SV40 enhancer region of the Enhancer and Control Vectors. Both primers can be used for sequencing double-stranded templates, but only RVprimer4 can be used for sequencing single-stranded templates.

Primer Sequences

• RVprimer3: 5´-d(CTAGCAAAATAGGCTGTCCC)-3´
• RVprimer4: 5´-d(GACGATAGTCATGCCCCGCG)-3´

Applications

• Determination of the exact position of generated deletions.
• Confirmation of production of a site-specific mutation.

« Collapse Content